Export thread

I was doing some labwork and came up with an idea for a Christmas gift for my girlfriend: there's a gene, FOXP2, that's implicated in language/speech in humans (yes, Chaz and DI, I know it's not proven; just the sentiment ).

She's a biologist too, and likes jewelry, so I was thinking of taking a sample of my DNA, amplifying the FOXP2 gene, filling a small glass vial, sealing it, and then integrating it into a necklace for her. Something to the tune of 'giving you my voice' and, the slightly more cliched, 'you take my voice away'.

So here's a poll for you guys

As long as it has meaning to BOTH of you, it's the perfect gift. If I gave something like that to my wife I'd get a funny look.

But you know your girlfriend better than any of us. If you think it's something that she'd treasure, by all means do it.

Sounds cool, but by all means DO NOT literally give her your heart. It never works out right.

I vote yes. I have no idea the science behind it, but the way you explained it, it sounds awesome.

You know ... provided she gets it. Which you say she will, because she works with this stuff. So I say go for it.

And if she likes The Little Mermaid (where the sea witch kept Ariel's voice in a seashell on her necklace) then double plus good.

-Adam

Problem: the gene appears to span around 280,000 base pairs, so amplifying it is... problematic. You're better off isolating RNA from some tissue expressing Foxp2 (which is hopefully not restricted to brain tissue), then amplifying the Foxp2 coding sequence via RT-PCR. You can then purify the band (~2200 base pairs) on an agarose gel.

Enresshou said:

I was thinking of taking a sample of my DNA, amplifying the FOXP2 gene,

Click to expand...

Jake said:

Problem: the gene appears to span around 280,000 base pairs, so amplifying it is... problematic. You're better off isolating RNA from some tissue expressing Foxp2 (which is hopefully not restricted to brain tissue), then amplifying the Foxp2 coding sequence via RT-PCR. You can then purify the band (~2200 base pairs) on an agarose gel.

Click to expand...

Get a room you two.

-Adam

I love it when you guys talk nerdy to us.

Jake said:

Problem: the gene appears to span around 280,000 base pairs, so amplifying it is... problematic. You're better off isolating RNA from some tissue expressing Foxp2 (which is hopefully not restricted to brain tissue), then amplifying the Foxp2 coding sequence via RT-PCR. You can then purify the band (~2200 base pairs) on an agarose gel.

Click to expand...

Ah, hadn't expected it to be that large. On the plus side, that'll work out fine (assuming it's not expressed only in brain tissue, of course), since we're already doing some RT-PCR work in the stem cell lab I'm in and I'm just learning how to do PCR purification. Thanks for the advice!

There are easier ways to get her to wear your genetic material, you know.

SeraRelm said:

There are easier ways to get her to wear your genetic material, you know.

Click to expand...

Enresshou said:

Jake said:

Problem: the gene appears to span around 280,000 base pairs, so amplifying it is... problematic. You're better off isolating RNA from some tissue expressing Foxp2 (which is hopefully not restricted to brain tissue), then amplifying the Foxp2 coding sequence via RT-PCR. You can then purify the band (~2200 base pairs) on an agarose gel.

Click to expand...

Ah, hadn't expected it to be that large. On the plus side, that'll work out fine (assuming it's not expressed only in brain tissue, of course), since we're already doing some RT-PCR work in the stem cell lab I'm in and I'm just learning how to do PCR purification. Thanks for the advice!

Click to expand...

Looks like you're in luck on the gene expression, as it appears to be all over the place:



Since you have the reverse transcriptase, PCR, and agarose gel electrophoresis stuff, you just need primers for the Foxp2 coding sequence. Invitrogen's design tool suggests "atgatgcaggaatctgcga" and "tcattccagatcttcagataaagg" (melting points around 60 C).

You should immediately start harvesting it from your ovaries, according to that chart.

-Adam

I don't understand the science behind it (all the nerdy talk is awesome tho) I think giving a gift that means something between the two of you is better than just a generic store bought gift without any thoughts behind it, but that is just me.

Jake said:

SeraRelm said:

There are easier ways to get her to wear your genetic material, you know.

Click to expand...

Click to expand...

You win one hundred internets for flawless execution, sir.

I like the concept, but I think the execution could use some work. Could you engrave either the nucleotide or peptide sequence on the piece of jewelry, like a bracelet? Were you planning to suspend the PCR product in ethanol? I can't think of any other way to visualize it.

What about taking her foxp2 pcr product and yours and doing a DNA-DNA hybridization? That way your voices will be in unison or whatever.

Also, once you have the sequences, you could submit them to NCBI and name the sequences some sort of code that only you and her would understand.

The crystal structure looks too complicated to do anything with it.

Cool idea. Let us know what you end up doing!

I think that's an incredibly romantic gift right there.

I like it, and I wish I was smart enough to do something like this.

Why are you not going with SOD3 instead of FOXP2? It's only about 5400 bases, and that way you can say that she takes your breath away instead of your voice.

--Patrick

PatrThom said:

Why are you not going with SOD3 instead of FOXP2? It's only about 5400 bases, and that way you can say that she takes your breath away instead of your voice.

--Patrick

Click to expand...

I have a form of synesthesia, so words (in all languages) have a texture, shape, and color to me. I'm trying to think up a way to say this without sounding cheesy, but I'm choosing FOXP2 because language is one of the central tenets of who I am.

I get the joke (and I loved that episode of Futurama), but I just feel language fits better.

If she gets the science/point behind it, awesome gift. Go for it!

Also, all the nerdy talk...*swoon* Have any female coworkers?

Give her a sex flowchart. Oh wait, this is only for males-

So that's what I did wrong, I never went to prom.

Rob King said:

Jake said:

SeraRelm said:

There are easier ways to get her to wear your genetic material, you know.

Click to expand...

Click to expand...

You win one hundred internets for flawless execution, sir.

Click to expand...

For repeating/explaining the joke?
You have low standards.

SeraRelm said:

You have low standards.

Click to expand...

It's true

And even so, I still can't get laid.

SeraRelm said:

For repeating/explaining the joke?
You have low standards.

Click to expand...

There's that ray of sunshine we've been waiting for! :clap:

Jake said:

SeraRelm said:

For repeating/explaining the joke?
You have low standards.

Click to expand...

There's that ray of sunshine we've been waiting for! :clap:

Click to expand...

:smug: :smug: :smug: